The development of high-yielding semidwarf varieties of wheat and rice led to a rapid increase in the global production of cereal grains, which more than doubled from 1960 to 1990 (Khush, 1999). The semidwarf rice variety, IR8, was developed by using the Chinese landrace ‘Dee-geo-woo-gen’ (DGWG) and released by the International Rice Research Institute (IRRI). It was known as “miracle rice” that responds well to fertilizer and produces an increased yield without culm elongation. Widespread adoption of the miracle rice  brought about a global “green revolution”, particularly in the monsoonal regions of Asia, where typhoons frequently occur during the harvesting season (Athwal, 1971; Khush, 1999).

The semidwarf character is one of a very important agronomic trait in crop breeding. In other countries, many other short-culm cultivars were developed using an independent source of semidwarfism germplasms, such as the Japanese indigenous landrace ‘Jukkoku’ (Okada et al., 1967), or γ-ray-induced semidwarf cultivars such as ‘Reimei’ in Japan and ‘Calrose 76’ in the USA (Foster and Rutger, 1978). Although dwarf varieties of rice have contributed to the dramatic improvement  and stabilization of yields worldwide, the dwarf stature of varieties derived from native or mutant maternal lines happens to be controlled by a single dwarf gene, sd1 (Kikuchi and Futsuhara, 1997; Monna et al., 2002; Spielmeyer et al., 2002; Sasaki et al., 2002; Ashikari et al., 2002). The sd1 allele is  located on the long arm of chromosome 1 (Cho et al., 1994a; 1994b; Maeda et al., 1997), which confers the semidwarf phenotype without  detrimental effects on grain yield (Hedden, 2003a; 2003b).

In Japan, Koshihikari suffers considerable lodging damage as a result of frequent powerful typhoons, and thus, developing of lodging-resistant cultivar has been a longstanding challenge. The author developed a dwarf Koshihikari-type cultivar, ‘Hikarishinseiki’ (Tomita, 2009; rice cultivar No.12273, Ministry of Agriculture, Forestry and Fisheries of Japan) using a dwarf cultivar line with the heading time same as Koshihikari-type, which was selected by intercrossing the F₄ of Kanto No. 79 (early-heading mutant line derived from Koshihikari) and Jukkoku (a cultivar with a semi-dwarf gene, sd1), as the maternal parent, and backcrossed it with Koshihikari 8 times. Having over 99.8% background of the Koshihikari genome, except for sd1, Hikarishinseiki would be the first cultivar to be registered as a Koshihikari-type dwarf with sd1 in Japan (Tomita, 2009).

The dwarf feature of Hikarishinseiki is derived from the semidwarf gene sd1. sd1 is a defective gene of GA20ox-2, which encodes a defective C20-oxidase in the gibberellin (GA) biosynthesis pathway (GA 20-oxidase, OsGA20ox2) (Monna et al., 2002; Spielmeyer et al., 2002; Sasaki et al., 2002; Ashikari et al., 2002). However, it has yet to be known whether the sd1 gene possessed by Hikarishinseiki is transcribed. Subsequently, expression analysis was conducted by employing the RT-PCR method and PmaCI restriction enzyme digestion in order to clarify whether or not the sd1 gene carried by Hikarishinseiki is transcribed.

An increasing number of private agricultural producers across Japan have spontaneously started to grow Hikarishinseiki as a typhoon-resistant, easy-to-grow cultivar instead of Koshihikari. As the recommended cultivars become widespread, there will become a growing need for information that rewards producers for their efforts. Here, we analyzed the results of 24 performance tests aimed at determining recommended cultivars, carried out over a period of two years from 2006 to 2007.

1 Results
1.1 Transcription of sd1, defective allele of GA20ox-2
We performed expression analysis of the sd1 gene, which is introduced in the dwarf Koshihikari-type paddy rice variety ‘Hikarishinseiki’. The two alleles at the sd1/OsGA20ox2 locus on chromosome 1 of each line, Koshihikari and Hikarishinseiki, were distinguished by RT-PCR amplification of the first exon followed by digestion with PmaCI (Figure 1; Figure 2). A 779 bp fragment, employing one type of upper primer (F1) designed from the 1^st exon and one type of downstream primer (R4) designed from the range of the 2^nd to 3^rd exon, contained only the exon. Moreover, 1,316 bp, 1,304 bp, 1,400 bp, and 1,366 bp fragments employing the four upper primers (F1~F4) designed from the 1^st exon and the downstream primer (R6) designed from the 3^rd exon, contained the 2^nd intron. Lastly, 1,428 bp, 1,416 bp, and 1,478 bp fragments, obtained using three upstream primers (F1~F3) designed from the 1^st exon and the RT primer (R5), contained both the 1^st intron and 2^nd intron. The target fragment was detected in these eight combinations of primers.

Figure 1 PCR primers designed for amplification of  cDNA derived from sd1 (GA20ox-2) transcript

Figure 2 PCR amplification of cDNA from sd1 (GA20ox-2) transcript and their PmaCI-digestion

RNA extracted from the root was used as the template then the 779 bp fragment by primers F1 and R4 was cleaved into the 613 bp and 166 bp fragments by PmaCI digestion in Hikarishinseiki (Figure 2). Accordingly, it can be said that sd1 was transcribed in Hikarishinseiki.

1.2 Trait expression of sd1 in the isogenic background through multiregional tests
We analyzed the data of performance tests conducted in 17 regions across Japan over a period of two years from 2006 to 2007 (Table 1; Table 2).

Table 1 Comparison of agronomic characters of Koshihikari and Hikarishinseiki in 2006

Table 2 Comparison of agronomic characters of Koshihikari and Hikarishinseiki in 2007

Heading: During the 2-year study period, Hikarishinseiki headed 'extremely early', on average 0.25 days earlier than Koshihikari.

Plant height: The average height of Hikarishinseiki is 72.2 cm (77% of Koshihikari, range 74% ~ 81%), which is on average 20.6 cm (23%) shorter than Koshihikari. There was very little difference in the national average values for plant height and other characteristics during the 3–year study period, and as a result, shown values represent 3-year averages.

Degrees of lodging: The average degree of lodging was 0.2, which is between ± 0 ~ +3.8, indicating a significant improvement in lodging resistance.

Ear length: Ear length was 18.3 cm (98% that of Koshihikari), and the ratio to Koshihikari ear length ranged from 90% to 107%.

Number of ears: The average number of ears was 429/m² (109% that of Koshihikari), and the ratio to Koshihikari ear number ranged from 96% to 117%. In Ishikawa prefecture, the number of ears was 10% more than that of Koshihikari in 2 consecutive years, and numbers were higher than Koshihikari in 90% of prefectures. Having a large number of ears is one of the notable characteristics of Hikarishinseiki.

Brown rice yield: The average brown rice yield over the 2 years was 56.5 kg/a (101% that from Koshihikari), but the ratio to that from Koshihikari varied significantly between regions from 86% to 124%. In some regions, average brown rice yield was ≥7% than that of Koshihikari in 2 consecutive years (Nagano: +13% in 2006, +8% in 2007, Ishikawa: +7% in 2006, +24% in 2007, Tottori: +8% in 2005, + 9% in 2006), while in other areas (Toyama and Tokushima) they were ≤5%, indicating regional differences in yield. Moreover, the yield and number of ears did not necessarily correspond. In some areas, Hikarishinseiki showed a larger yield but similar number of ears compared to Koshihikari.

Grain weight of brown rice: The average grain weight of Hikarishinseiki brown rice was 22.0 g (101% that of Koshihikari, ranging from 96% to 105%).

Brown rice quality: The average brown rice quality was 4.6 and the difference with that of Koshihikari ranged from +1.0 to -1.5. This score indicates ‘medium’ quality, the same class quality given to Koshihikari.

Taste: Overall taste was on average -0.1 using Koshihikari as the base cultivar. This score indicates a ‘better than average’ rating, equaling that of Koshihikari.

The difference between Hikarishinseiki and Koshihikari ranged from +0.25 to -0.64, and the average was -0.06 when Ishikawa prefecture (2005: -0.64, 2007: -0.59), where stricter taste standards are applied, was not included.

As shown above, although the characteristics of Hikarishinseiki as a dwarf variety of Koshihikari have now been clarified, significant regional differences in yield were revealed compared to Koshihikari. This may give us clues as to how yield can be further increased.

2 Discussion
Although Koshihikari is a dominant   variety of rice, representing 40% of the rice cropping area in Japan, problem arises as a result of lodging during heavy rainstorms. In order to solve this problem, the dwarf Koshihikari-type paddy rice variety ‘Hikarishinseiki’, which shows stronger lodging resistance than that of Koshihikari and has 99.8% or more of the Koshihikari genome, was developed.

‘Koshihikari sd1’ was developed from first crossing ‘Jukkoku’ (sd1sd1) with ‘Kanto No. 79’ (Sd1Sd1), an early-maturing mutant of ‘Koshihikari’ (Tomita, 2009). The pedigree method  was conducted in breeding program during the later generations of ‘Kanto 79’ x ‘Jikkoku’, and then the dwarf sd1 homozygous line  (‘Jikkoku’-type ‘Koshihikari’) whose heading date was the same as ‘Koshihikari’,  was selected and fixed in the F₄ generation. The flanking substituted region adjacent to sd1 had been restricted by eight  recurrent backcrossing  between the Sd1sd1 descendants of ‘Jikkoku’-type ‘Koshihikari’ short line and ‘Koshihikari’ (Sd1Sd1) as the recurrent parent. The semidwarf phenotype (sd1sd1) was done by the BC₈F₃ generation, therefore in which ‘Koshihikari sd1’ line carried ≥99.8% of ‘Koshihikari’ background in their genome.

In this study, the two alleles at the sd1/OsGA20ox2 locus on chromosome 1 of each line, Koshihikari and Hikarishinseiki, were successfully distinguished by RT-PCR amplification of the first exon followed by digestion with PmaCI. RNA extracted from the root was employed as the template then the 779 bp fragment was clearly cleaved into the 613 bp and 166 bp fragments by PmaCI digestion in Hikarishinseiki, but not cleaved in Koshihkari. Therefore, it is concluded that sd1 gene derived from Jukkoku was transcribed in Hikarishinseiki. This study would be  a first evidence  of the transcription of sd1, a defective gene of GA20ox-2, that contributed to Green Revolution in rice.

Hikarishinseiki would be considered to be an alternative to  Koshihikari, being resistant to typhoon damage and easy to grow, and it was designated as a brand rice description in the rice-producing districts in Okayama, Tottori, Tokushima, Niigata, Kochi, Shiga, Mie, Kagawa, Hyogo, Kyoto, Hiroshima, Tochigi, and Kumamoto prefectures (by courtesy of Ministry of Agriculture, Forestry and Fisheries of Japan). In this study, the taste and quality of Hikarishinseiki were in line with Koshihikari across Japan during two years, and it would be  practically valuable from the standpoint of production and distribution. Nowadays, preliminary tests to determine recommended cultivars have been carried out extensively across Japan, with three prefectures, Tottori, Wakayama, and Kanagawa, having proceeded to main tests.

3 Methods
3.1 Transcription analysis of sd1
Expression analysis of sd1 was conducted by RT-PCR assay using RNA extracted from the leaves of Hikarishinseiki and Koshihikari grown since June 2009 at the farm of Tottori University and the roots of Hikarishinseiki and Koshihikari germinated on a Petri dish in the laboratory. After the reverse transcription reaction using an RT primer (R6:TCAGCTGGCCGCCTCGACCTGCGCCG) designed from the 3' end of sd1 (Os01g0883800), RT-PCR was performed with 24 combinations of the following types of primers: four upstream primers (F1:GGAGCCCAAGATCCCGGAGCCATTCGTG, F2: CGACCTGAGGATGGAGCCCAAGATCCCG, F3: GACTCCACCGCCGGCTCTGGCATTGC, F4: CACGCCACCACAGCCGCACCAACCAC designed from the 1^st exon of sd1) and six downstream primers (R1: GAGGGTGCTGGAGAAGTAGTCGGCGAC designed from the 1^st exon of sd1, R2: CACCCTCCCCATTGGCGCGAAGTCGG from the range of the 1^st to 2^nd exon, R3: TACCATGAAGGTGTCGCCGATGTTGATGACC from the 2^nd exon, R4: CGTTCGACAGCGCCATGAAGGTGTCGCC from the range of the 2^nd to 3^rd exon, R5: TCAGCTGGCCGCCTCGACCTG from the 3^rd exon, and R6 mentioned above designed from the 3' end). Primer designing was based on the public sequence of Nipponbare (http://rgp.dna.affrc.go.jp). Since sd1 confers GA20ox-2 and shares homology with GA20ox-1 (Os03g0856700), the primer was designed from the region showing low homology between GA20ox-2 and GA20ox-1, allowing distinct labeling of GA20ox-2 and GA20ox-1, respectively. PCR amplification took place in a 20 µL containing:  10 ng  genomic DNA, 1 µM of each primer, 0.4 mM dNTPs, 1 × GC buffer â… , 2.5 mM MgCl₂, and 0.5 unit of LA Taq polymerase (TaKaRa) in a total volume of 20 µL. And using following cycling conditions: 35 cycles,  94°C 30 s,  58°C 30 s, and  72°C 1 min. PCR products were treated  with the restriction enzyme PmaCI (CAC↓GTG), which can detect a single base substitution site of sd1 in the 1^st exon of sd1 from Hikarishinseiki according to Tomita (2009). The transcription product of sd1 was then analyzed.

3.2 Performance test of sd1 in the isogenic background
Performance tests were carried out in a paddy field at Tottori University, Koyama, during 2006 and 2007. ‘Hikarishinseiki’ and ‘Koshihikari’ were sown on 20 April 2006 and on 21 April 2007, and 128 seedlings per plot were transplanted with two replications on 15 and 17 May, respectively. Similar performance tests were conducted at experimental stations in Miyagi, Ibaraki, Kanagawa, Nagano, Mie, Toyama, Ishikawa Kyoto, Wakayama, Hyogo, Shimane, Okayama, Tokushima, Ehime, Oita and Kumamoto, which are spread across Japan.

The date was recorded as the heading date once when 50% of all panicles had emerged from the flag leaf sheath. Days-to-heading was the number of days from sowing date to heading date. Culm length, panicle length, number of panicles, leaf length, and leaf width were measured on 10 randomly selected individuals in each plot. Thousand-grain weight, grain yield of brown rice, grain quality, and eating quality were measured on bulks of 50 individuals. The means of traits were statistically compared using the t-test.

Author’s contributions
MT conceived and designed the study and wrote the manuscript. MT and SM performed the experiments and analyzed the data. Both of authors read and approved the final manuscript.

Acknowledgements
The authors would like to express our gratitude to Japan Science and Technology Agency (JST) for the Grant-in-Aid for Adaptable and Seamless Technology Transfer Program through Target-driven R & D (No. 08150094 and No. 08001167) that supported this work to Motonori Tomita. We thank to all those who provided test data from prefectures across Japan. 

Reference
Ashikari, M., Sasaki A., Ueguchi-Tanaka M., Itoh H., Nishimura A., Datta S., Ishiyama K., Saito T., Kobayashi M., Khush G.S., Kitan, H.　and Matsuoka M., 2002, Loss-of-function of a rice gibberellin biosynthetic gene, GA20 oxidase (GA20ox-2), led to the rice ‘green revolution’, Breed. Sci., 52(2): 143-150 http://dx.doi.org/10.1270/jsbbs.52.143

Athwal D.S., 1971, Semidwarf rice and wheat in global food needs, Quart. Review Biol., 46(1): 1-34 http://dx.doi.org/10.1086/406754 PMid:4927378

Cho Y.G., Eun M.Y., Kim Y.K., Chung T.Y., and Chae Y.A., 1994a, The semidwarf gene, sd-1, of rice (Oryza sativa L). 1. Linkage with the esterase locus, EstI-2, Theor. Appl. Genet., 89(1): 49-53 http://dx.doi.org/10.1007/BF00226981

Cho Y.G., Eun M.Y., McCouch S.R., and Chae Y.A., 1994b, The semidwarf gene, sd-1, of rice (Oryza sativa L.). 2. Molecular mapping and marker-assisted selection, Theor. Appl. Genet., 89(1): 54-59 http://dx.doi.org/10.1007/BF00226982

Foster K.W. and Rutger J.N., 1978, Inheritance of semidwarfism in rice, Oryza sativa L., Genetics, 88(1): 559-574 PMid:17248812    PMCid:1224601

Hedden P., 2003a, Constructing dwarf rice, Nature Biotechnol., 21(8): 873-874 http://dx.doi.org/10.1038/nbt0803-873 PMid:12894201

Hedden P., 2003b, The genes of the Green Revolution, Trends Genet., 19(1): 5-9 http://dx.doi.org/10.1016/S0168-9525(02)00009-4

Kashiwagi T., Togawa E., Hirots, N. and Ishimaru K., 2008, Improvement of lodging resistance with QTLs for stem diameter in rice (Oryza sativa L.), Theor. Appl. Genet., 117(5): 749-757 http://dx.doi.org/10.1007/s00122-008-0816-1 PMid:18575836

Khush G.S., 1999, Green revolution: preparing for the 21st century, Genome, 42(4): 646-655 http://dx.doi.org/10.1139/g99-044 PMid:10464789

Kikuchi F., and Futsuhara Y., 1997, Inheritance of morphological characters. 2. Inheritance of semidwarf, In: Matsuo T., Shimizu S., Tsunoda S., Murata Y., Kumazawa K., Futsuhara Y., Hoshikawa K., Yamaguchi H. and Kikuchi F., editors, Science of the Rice Plant, Vol. 3, Tokyo: Tokyo Food and Agricultural Policy Research Center, pp.309-317

Maeda H., Ishii T., Mori H., Kuroda J., Horimoto M., Takamur, I., Kinoshita T., and Kamijima O., 1997, High density molecular map of semidwarfing gene, sd-1, in rice (Oryza sativa L.), Breed. Sci., 47(4): 317-320

Monna L., Kitazawa N., Yoshino R., Suzuki J., Masuda H., Maehar, Y., Tanji M., Sato M., Nas, S. and Minobe Y., 2002, Positional cloning of rice semidwarfing gene, sd-1: Rice “Green revolution gene” encodes a mutant enzyme involved in gibberellin synthesis, DNA Res., 9(1): 11-17 http://dx.doi.org/10.1093/dnares/9.1.11 PMid:11939564

Okada M., Yamakawa Y., Fujii K., Nishiyama H., Motomura H., Kai S., and Imai T., 1967, On the new varieties of paddy rice, ‘Hoyoku’, ‘Kokumasari’ and ‘Shiranui’, Bull. Kyushu Agr. Exp. Sta., 12(3, 4): 187-224

Sasaki A., Ashikari M., Ueguchi-Tanaka M., Itoh H., Nishimura A., Swapan D., Ishiyama K., Saito T., Kobayashi M., Khush G.S., Kitano H., and Matsuoka M., 2002, Green revolution: a mutant gibberellin-synthesis gene in rice, Nature, 416(6882): 701-702 http://dx.doi.org/10.1038/416701a PMid:11961544

Spielmeyer W., Ellis M.H., and Chandler P.M., 2002, Semidwarf (sd-1), “green revolution” rice, contains a defective gibberellin 20-oxidase gene, Proc. Natl. Acad. Sci., USA, 99(13): 9043-9048 http://dx.doi.org/10.1073/pnas.132266399 PMid:12077303    PMCid:124420

Tomita M., 2009, Introgression of Green Revolution sd1 gene into isogenic genome of rice super cultivar Koshihikari to create novel semidwarf cultivar 'Hikarishinseiki' (Koshihikari-sd1), Field Crops Res., 114(2): 173–181 http://dx.doi.org/10.1016/j.fcr.2009.05.004